Updated November 2016

The ITS protocol detailed here is designed to amplify fungal microbial eukaryotic lineages using paired-end community sequencing on the Illumina platform with primers ITS1f-ITS2 (EMP.ITSkabir).

For running these libraries on the MiSeq and HiSeq, please make sure you read the supplementary methods of Caporaso et al. (2012). You will need to make your sample more complex by adding 5-10% PhiX to your run.

Ordering primers

The primer sequences in this protocol are always listed in the 5′ -> 3′ orientation. This is the orientation that should be used for ordering. See the page Primer Ordering and Resuspension for more information. Primer constructs were designed by Dylan Smith and Kabir Peay.

EMP.ITSkabir forward primer

Field descriptions (space-delimited):

  1. 5′ Illumina adapter
  2. Forward primer linker
  3. Forward primer (ITS1f)

AATGATACGGCGACCACCGAGATCTACAC GG CTTGGTCATTTAGAGGAAGTAA

EMP.ITSkabir reverse primer, barcoded

Field descriptions (space-delimited):

  1. Reverse complement of 3′ Illumina adapter
  2. Golay barcode
  3. Reverse primer linker
  4. Reverse primer (ITS2)

CAAGCAGAAGACGGCATACGAGAT NNNNNNNNNN CG GCTGCGTTCTTCATCGATGC

PCR reaction mixtures

Reagent Volume
PCR-grade water 13.0 µL
PCR master mix (2x) 10.0 µL
Forward primer (10 µM) 0.5 µL
Reverse primer (10 µM) 0.5 µL
Template DNA 1.0 µL
Total reaction volume 25.0 µL

Notes:

  • PCR-grade water from Sigma (cat. no. W3500) or MoBio (cat. no. 17000-11)
  • Platinum Hot Start PCR Master Mix (2x) from ThermoFisher (cat. no. 13000014)
  • Final master mix concentration in 1x reaction: 0.8x
  • Final primer concentration in 1x reaction: 0.2 µM

Thermocycler conditions

ITS amplification

  • Primers: ITS1f-ITS2
  • Amplicon size: ~230 bp
Temperature Time Repeat
94 °C 1 min
94 °C 30 s x35
52 °C 30 s x35
68 °C 30 s x35
68 °C 7 min
4 °C hold

Amplification protocol

  1. Amplify samples in triplicate, meaning each sample will be amplified in 3 replicate 25-µL PCR reactions.
  2. Pool triplicate PCR reactions for each sample into a single volume (75 µL). Do not combine amplicons from different samples at this point.
  3. Run amplicons from each sample on an agarose gel. Expected band size for ITS1f-ITS2 is ~230 bp. Low-biomass samples may yield faint or no visible bands; alternative methods such as a Bioanalyzer could be used to verify presence of PCR product.
  4. Quantify amplicons with Quant-iT PicoGreen dsDNA Assay Kit (ThermoFisher/Invitrogen cat. no. P11496; follow manufacturer’s instructions).
  5. Combine an equal amount of amplicon from each sample (240 ng) into a single, sterile tube. Higher amounts can be used if the final pool will be gel-isolated or when working with low-biomass samples. Note: When working with multiple plates of samples, it is typical to produce a single tube of amplicons for each plate of samples.
  6. Clean amplicon pool using MoBio UltraClean PCR Clean-Up Kit (cat. no. 12500; follow manufacturer’s instructions). If working with more than 96 samples, the pool may need to be split evenly for cleaning and then recombined. Optional: If spurious bands were present on gel (in step 3), one-half of the final pool can be run on a gel and then gel extracted to select only the target bands.
  7. Measure concentration and A260/A280 ratio of final pool that has been cleaned. For best results the A260/A280 ratio should be between 1.8-2.0.
  8. Send an aliquot for sequencing along with sequencing primers listed below.

ITS sequencing primers

Read 1 sequencing primer

Field descriptions (space-delimited):

  1. Forward primer segment
  2. Extended region into amplicon

TTGGTCATTTAGAGGAAGTAA AAGTCGTAACAAGGTTTCC

Read 2 sequencing primer

Field descriptions (space-delimited):

  1. Reverse primer segment
  2. Extended region into amplicon

CGTTCTTCATCGATGC VAGARCCAAGAGATC

Index sequencing primer

  1. Reverse complement of extended amplicon region
  2. Reverse complement of reverse primer
  3. Reverse complement of linker

TCTC GCATCGATGAAGAACGCAGC CG

References

  • Caporaso, J. G. et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J (2012). doi:10.1038/ismej.2012.8
  • Walters, W. et al. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys. mSystems 1, 915 (2016).
  • Smith, D. P. & Peay, K. G. Sequence depth, not PCR replication, improves ecological inference from next generation DNA sequencing. PLoS ONE 9, e90234–e90234 (2014).
  • White, T. J., Bruns, T., Lee, S. & Taylor, J. in PCR protocols: a guide to methods and applications 315–322 (Academic Press, 1990).
  • Gardes, M. & Bruns, T. D. ITS primers with enhanced specificity for basidiomycetes ‐ application to the identification of mycorrhizae and rusts. Mol Ecol 2, 113–118 (1993).