Updated November 2016

The 16S protocol detailed here is designed to amplify prokaryotes (bacteria and archaea) using paired-end 16S community sequencing on the Illumina platform. Primers 515f-806r target the V4 region of the 16S SSU rRNA.

For running these libraries on the MiSeq and HiSeq, please make sure you read the supplementary methods of Caporaso et al. (2012). You will need to make your sample more complex by adding 5-10% PhiX to your run.

16S amplification primers

The 515f-806r primer pair has been modified in the following ways:

  1. Barcodes are now on the forward primer of the 515f-806rB primer pair. This enables the usage of various reverse primer constructs to obtain longer amplicons (tested on 806r and 926r).
  2. Degeneracy was added to both the forward and reverse primers to remove known biases against Crenarachaeota/Thaumarchaeota (515f modification) and the marine and freshwater Alphaproteobacterial clade SAR11 (806r modification). For specific details about the 515f-806rB primer pair, please see Parada et al. (2014) and Apprill et al. (2015).

Ordering primers

The primer sequences in this protocol are always listed in the 5′ -> 3′ orientation. This is the orientation that should be used for ordering. See the page Primer Ordering and Resuspension for more information. Primer constructs were designed by Greg Caporaso. Modifications to primer degeneracy were done by Jed Furhman and Amy Apprill. Forward-barcoded constructs were redesigned by Walters et al. (2016) based upon the original constructs generated by Caporaso et al. (2012).

515fB forward primer, barcoded

Field descriptions (space-delimited):

  1. 5′ Illumina adapter
  2. Golay barcode
  3. Forward primer pad
  4. Forward primer linker
  5. Forward primer (515fB)

AATGATACGGCGACCACCGAGATCTACACGCT XXXXXXXXXXXX TATGGTAATT GT GTGYCAGCMGCCGCGGTAA

806rB reverse primer

Field descriptions (space-delimited):

  1. Reverse complement of 3′ Illumina adapter
  2. Reverse primer pad
  3. Reverse primer linker
  4. Reverse primer (806rB)

CAAGCAGAAGACGGCATACGAGAT AGTCAGCCAG CC GGACTACNVGGGTWTCTAAT

PCR reaction mixture

Reagent Volume
PCR-grade water 13.0 µL
PCR master mix (2x) 10.0 µL
Forward primer (10 µM) 0.5 µL
Reverse primer (10 µM) 0.5 µL
Template DNA 1.0 µL
Total reaction volume 25.0 µL

Notes:

  • PCR-grade water from Sigma (cat. no. W3500) or MoBio (cat. no. 17000-11)
  • Platinum Hot Start PCR Master Mix (2x) from ThermoFisher (cat. no. 13000014)
  • Final master mix concentration in 1x reaction: 0.8x
  • Final primer concentration in 1x reaction: 0.2 µM

Thermocycler conditions

  • Primers: 16S V4 515f-806rB
  • Amplicon size: ~390 bp
  • Cycle times are longer for 384-well thermocyclers.
Temperature Time, 96-well Time, 384-well Repeat
94 °C 3 min 3 min
94 °C 45 s 60 s x35
50 °C 60 s 60 s x35
72 °C 90 s 105 s x35
72 °C 10 min 10 min
4 °C hold hold

Amplification protocol

  1. Amplify samples in triplicate, meaning each sample will be amplified in 3 replicate 25-µL PCR reactions.
  2. Pool triplicate PCR reactions for each sample into a single volume (75 µL). Do not combine amplicons from different samples at this point.
  3. Run amplicons from each sample on an agarose gel. Expected band size for 515f-806r is ~300-350 bp. Low-biomass samples may yield faint or no visible bands; alternative methods such as a Bioanalyzer could be used to verify presence of PCR product.
  4. Quantify amplicons with Quant-iT PicoGreen dsDNA Assay Kit (ThermoFisher/Invitrogen cat. no. P11496; follow manufacturer’s instructions).
  5. Combine an equal amount of amplicon from each sample (240 ng) into a single, sterile tube. Higher amounts can be used if the final pool will be gel-isolated or when working with low-biomass samples. Note: When working with multiple plates of samples, it is typical to produce a single tube of amplicons for each plate of samples.
  6. Clean amplicon pool using MoBio UltraClean PCR Clean-Up Kit (cat. no. 12500; follow manufacturer’s instructions). If working with more than 96 samples, the pool may need to be split evenly for cleaning and then recombined. Optional: If spurious bands were present on gel (in step 3), one-half of the final pool can be run on a gel and then gel extracted to select only the target bands.
  7. Measure concentration and A260/A280 ratio of final pool that has been cleaned. For best results the A260/A280 ratio should be between 1.8-2.0.
  8. Send an aliquot for sequencing along with sequencing primers listed below.

16S sequencing primers

Read 1 sequencing primer

Field descriptions (space-delimited):

  1. Forward primer pad
  2. Forward primer linker
  3. Forward primer

TATGGTAATT GT GTGYCAGCMGCCGCGGTAA

Read 2 sequencing primer

Field descriptions (space-delimited):

  1. Reverse primer pad
  2. Reverse primer linker
  3. Reverse primer

AGTCAGCCAG CC GGACTACNVGGGTWTCTAAT

Index sequencing primer

AATGATACGGCGACCACCGAGATCTACACGCT

References

  • Caporaso, J. G. et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J (2012). doi:10.1038/ismej.2012.8
  • Caporaso, J. G. et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proc Natl Acad Sci USA 108, 4516–4522 (2011).
  • Walters, W. et al. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys. mSystems 1, 915 (2016).
  • Parada, A. E., Needham, D. M. & Fuhrman, J. A. Every base matters: assessing small subunit rRNA primers for marine microbiomes with mock communities, time series and global field samples. Environ Microbiol 18, 1403–1414
  • Apprill, A., McNally, S., Parsons, R. & Weber, L. Minor revision to V4 region SSU rRNA 806R gene primer greatly increases detection of SAR11 bacterioplankton. Aquat. Microb. Ecol. 75, 129–137 (2015).